Sequence ID | >WENV170014596 |
Genome ID | AYRH01027075 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 233 |
End posion on genome | 157 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
nnntcttcgt |
tRNA gene sequence |
CGGGATATAGCGCAGCCTGGTAGCGCACTTGCATGGGGTGCAAGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tttagaatac |
Secondary structure (Cloverleaf model) | >WENV170014596 Pro GGG t ACCA tttagaatac C - G G - C G - C G - C A - T T - A A - T T A T C G C C C A C G A A | + | | | G C C G C G G T G G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |