Sequence ID | >WENV170014598 |
Genome ID | AYRH01029300 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 199 |
End posion on genome | 124 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ttttccagat |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTCGCTGGCAGCGAAGAGGTCTGCGGTTCGATC |
Downstream region at tRNA end position |
tctttaagta |
Secondary structure (Cloverleaf model) | >WENV170014598 Ala GGC t ACCA tctttaagta G - C G - C G + T G - C C - G T - A A - T C T T A C G C C A C G A A | | | | | G T C T C G T G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |