Sequence ID | >WENV170014600 |
Genome ID | AYRH01031973 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 86 |
End posion on genome | 2 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggtcgatctc |
tRNA gene sequence |
GGAGGAGTGCCCGAGTGGCTAAAGGGGGCGGACTGTAAATCCGCTGGCTATGCCTACGTT |
Downstream region at tRNA end position |
tnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014600 Tyr GTA c ACCA tnnnnnnnnn G - C G - C A - T G - C G - C A - T G - C T A T C A A C C A T G A G | | | | | G G G C C C G T T G G C G | | | T T C A G G G T A A G TGGCTATGCCTAC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |