Sequence ID | >WENV170014603 |
Genome ID | AYRH01033826 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 105 |
End posion on genome | 191 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tccataatcc |
tRNA gene sequence |
GCCCGGATGATGGAATTGGTAGACATAGGAGACTTAAAATCTCCCGATCGAAAGATCGTG |
Downstream region at tRNA end position |
tttcagctat |
Secondary structure (Cloverleaf model) | >WENV170014603 Leu TAA c ACCA tttcagctat G - C C - G C - G C - G G - C G - C A - T T G T C G G C C A T A A G | | | | | A T G G T A G C C G G C G | | | T T G A C A T T A G A CGATCGAAAGATCGT G - C G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |