Sequence ID | >WENV170014614 |
Genome ID | AYSL01000884 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 273 |
End posion on genome | 362 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cccatcccac |
tRNA gene sequence |
GGAGCGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGGAACCGTC |
Downstream region at tRNA end position |
aatgccctga |
Secondary structure (Cloverleaf model) | >WENV170014614 Ser GGA c GCCA aatgccctga G - C G - C A - T G - C C - G G - C G + T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCGGGGAACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |