Sequence ID | >WENV170014623 |
Genome ID | AYSL01001385 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 202 |
End posion on genome | 292 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tacaaaattt |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGCTGAAGGCGCACGCCTGGAAAGTGTGTATACGTTTATAGCGT |
Downstream region at tRNA end position |
aatacaaaga |
Secondary structure (Cloverleaf model) | >WENV170014623 Ser GGA t GCCA aatacaaaga G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G + | | T T C A G G C T G A G TATACGTTTATAGCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |