Sequence ID | >WENV170014633 |
Genome ID | AYSL01001730 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 187 |
End posion on genome | 270 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agtctacatt |
tRNA gene sequence |
GCGGAAGTGGTGGAATTGGTAGACACGCTGGATTTAGGTTCCAGTGCTTCACGGCGTGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014633 Leu TAG t ACCn nnnnnnnnnn G - C C - G G - C G - C A - T A - T G - C T G T C T C T C A T A A G | | | | | A T G G T G G A G A G C G | | | T T G A C A C T A G G TGCTTCACGGCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |