Sequence ID | >WENV170014639 |
Genome ID | AYSL01002090 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 107 |
End posion on genome | 180 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caccttgatt |
tRNA gene sequence |
GGCTGGATGGCAGAGTGGTCATGCAGCGGACTGCAACTCCGTTAACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
attatttatt |
Secondary structure (Cloverleaf model) | >WENV170014639 Cys GCA t TCCA attatttatt G - C G - C C - G T - A G - C G - C A - T T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T C A TAAC G + T C - G G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |