Sequence ID | >WENV170014648 |
Genome ID | AYSL01002402 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 2169 |
End posion on genome | 2265 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
agacggcttC |
tRNA gene sequence |
GGAGGGGAATCGTCTCTGGTGGGGCGGCCGGACTTCAAATCCGGTTGGGGCAGCGAGCCT |
Downstream region at tRNA end position |
Aatccgaccg |
Secondary structure (Cloverleaf model) | >WENV170014648 SeC(p) TCA C CGCC Aatccgaccg G - C G + T A C G + T G - C G - C G + T T C A T A C C C A C T C A + | | | | G T T G C T G T G G G C G + + T T G G G C G T G G G TTGGGGCAGCGAGCCTGTCCCGG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |