Sequence ID | >WENV170014664 |
Genome ID | AYSL01003440 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 1332 |
End posion on genome | 1415 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
agcaccctta |
tRNA gene sequence |
GGTGGGATTGGGGAGCGGTCAAACCCAACAGACTGTAAATCTGTCGCGAAAGCTTCGAAG |
Downstream region at tRNA end position |
tattttttta |
Secondary structure (Cloverleaf model) | >WENV170014664 Tyr GTA a ACCA tattttttta G - C G - C T - A G - C G - C G - C A - T T A T C T T C C A C G A T | | | | | G G G G G G G A A G G C G | | | T T T A C C C C A A A CGCGAAAGCTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |