Sequence ID | >WENV170014680 |
Genome ID | AYSL01004808 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 4535 |
End posion on genome | 4608 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agacgcatct |
tRNA gene sequence |
GGCGGAATGGCAGAATGGCTATGCAGCGGATTGCAAATCCGTCTATCTCGGTTCGACTCC |
Downstream region at tRNA end position |
aacgctgcaa |
Secondary structure (Cloverleaf model) | >WENV170014680 Cys GCA t TCCA aacgctgcaa G - C G - C C - G G - C G - C A - T A - T T C T G G G C C A A A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A CTAT G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |