Sequence ID | >WENV170014685 |
Genome ID | AYSL01005045 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 12 |
End posion on genome | 103 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cgtcacttca |
tRNA gene sequence |
GGAGAGTTGGCAGAGCCCGGTTTAATGCACCTGACTTGAAATCAGACGTGGGGTCAAACC |
Downstream region at tRNA end position |
aatacgaaaa |
Secondary structure (Cloverleaf model) | >WENV170014685 Ser TGA a GCCA aatacgaaaa G - C G - C A - T G - C A - T G - C T - A T A T C T C C C A C C G A G | + | | | G C G A C G G G G G G C G | | | T T G A T G C T T T A A CGTGGGGTCAAACCCACC C A C - G T - A G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |