Sequence ID | >WENV170014689 |
Genome ID | AYSL01005283 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 1096 |
End posion on genome | 1012 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccatcaatct |
tRNA gene sequence |
GGAGGGGTACCCAAGCGGTCAACGGGAGCAGACTGTAAATCTGCCGGCTCAGCCTTCGCA |
Downstream region at tRNA end position |
ctttctctat |
Secondary structure (Cloverleaf model) | >WENV170014689 Tyr GTA t ACCA ctttctctat G - C G - C A - T G - C G - C G - C G - C T A T C G T C C A C G A A | | | | | G G A C C C G C A G G C G | | | T T T C G G G C A A A CGGCTCAGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |