Sequence ID | >WENV170014692 |
Genome ID | AYSL01005352 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 270 |
End posion on genome | 354 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcagcaaagt |
tRNA gene sequence |
GCGGGTGTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGCGTGGG |
Downstream region at tRNA end position |
cttttcaaga |
Secondary structure (Cloverleaf model) | >WENV170014692 Leu TAG t ACCA cttttcaaga G - C C - G G - C G - C G - C T - A G - C T G T C T C C C A T A A G | + | | | A T A G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCGAGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |