Sequence ID | >WENV170014695 |
Genome ID | AYSL01005626 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 939 |
End posion on genome | 1012 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
caagatctgt |
tRNA gene sequence |
GGCCCGTTAGCTCAGTGGTAGAGCGTCCCGTTTACACCGGGTCGTCGGCAGTTCAAATCT |
Downstream region at tRNA end position |
ttgtatatct |
Secondary structure (Cloverleaf model) | >WENV170014695 Val TAC t ACCA ttgtatatct G + T G - C C - G C - G C - G G - C T - A T A T C T G T C A G A A | + | | | A T C T C G G G C A G C G | | | | T T G G A G C T A G CGTC T T C - G C - G C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |