Sequence ID | >WENV170014696 |
Genome ID | AYSL01005641 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 908 |
End posion on genome | 981 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caccacggat |
tRNA gene sequence |
GGCGAGTTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACACCGGTTCGATTCC |
Downstream region at tRNA end position |
cgaaaaccac |
Secondary structure (Cloverleaf model) | >WENV170014696 Cys GCA t TCCA cgaaaaccac G - C G - C C - G G - C A - T G - C T - A T T T T G G C C A G A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |