Sequence ID | >WENV170014720 |
Genome ID | AYSL01006879 |
Search identical group | |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 90 |
End posion on genome | 1 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgggtcggc |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCACTCCCCTGCTAAGGGAGTAGGCCCGGAAGGGTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014720 Ser GCT c GCCA nnnnnnnnnn G - C G - C A - T G - C A - T C - G G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A A TAGGCCCGGAAGGGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |