Sequence ID | >WENV170014727 |
Genome ID | AYSL01007342 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 3721 |
End posion on genome | 3795 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgatgaatca |
tRNA gene sequence |
GCGGGATTAGCTCAGTGGTAGAGCATAACCTTGCCAAGGTTGGGGTCGAGAGTTCGAATC |
Downstream region at tRNA end position |
aatactaaaa |
Secondary structure (Cloverleaf model) | >WENV170014727 Gly GCC a TCCA aatactaaaa G - C C - G G - C G - C G - C A - T T - A T A T T T C T C A G A A + | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A A GGGTC T + G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |