Sequence ID | >WENV170014745 |
Genome ID | AYSL01008790 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 509 |
End posion on genome | 426 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccggtcaatc |
tRNA gene sequence |
GGGGGCGTGGCGGAATGGTAGACGCGACGGATTCAAAATCCGTTTCAGCAATGAGTGCCG |
Downstream region at tRNA end position |
cgctctttcc |
Secondary structure (Cloverleaf model) | >WENV170014745 Leu CAA c ACCA cgctctttcc G + T G - C G - C G - C G - C C - G G - C T G T C G G C C A T A A G | | | | | G G G G C G G C C G G C G | | | T T T A C G C A G G TTCAGCAATGAGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |