Sequence ID | >WENV170014756 |
Genome ID | AYSL01009402 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 152 |
End posion on genome | 66 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cttctaacat |
tRNA gene sequence |
GCCAGTGTGATGGAATTGGTAGACATGACGGATTCAAAATCCGTTGCCTTTAAAAGCGTG |
Downstream region at tRNA end position |
tatagcagta |
Secondary structure (Cloverleaf model) | >WENV170014756 Leu CAA t ACCA tatagcagta G + T C - G C - G A - T G - C T - A G - C T G T C A G C C A T A A G | | | | | G T G G T A G T C G G C G | | | T T G A C A T T A G G TGCCTTTAAAAGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |