Sequence ID | >WENV170014758 |
Genome ID | AYSL01009453 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 272 |
End posion on genome | 345 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggacgacgat |
tRNA gene sequence |
GCCGGCTTAGCTCAGTGGTAGAGCGTCTGATTTGTAATCAGGGGGTCGGGGTTCAAATCC |
Downstream region at tRNA end position |
agtttccctt |
Secondary structure (Cloverleaf model) | >WENV170014758 Thr TGT t ACCA agtttccctt G - C C - G C - G G - C G - C C - G T - A T A T C T C C C A G A A + | | | A T C T C G C G G G G C G | | | | T T G G A G C T A G GGGT T + G C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |