Sequence ID | >WENV170014779 |
Genome ID | AZIB01000034 |
Phylum/Class | [AZIB] marine sediment metagenome; sample MGS-HAV from oil contaminated site at the Gulf of Genoa where a Haven tanker sank in |
Species | |
Start position on genome | 3318 |
End posion on genome | 3402 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acaaggcttt |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGGA |
Downstream region at tRNA end position |
ttttgagttt |
Secondary structure (Cloverleaf model) | >WENV170014779 Tyr GTA t ACCA ttttgagttt G - C G - C A - T G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | G G G C C C G G A G G C G | | | T T C A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |