Sequence ID | >WENV170014792 |
Genome ID | AZIB01000826 |
Phylum/Class | [AZIB] marine sediment metagenome; sample MGS-HAV from oil contaminated site at the Gulf of Genoa where a Haven tanker sank in |
Species | |
Start position on genome | 583 |
End posion on genome | 498 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gtttttaatt |
tRNA gene sequence |
GCCGGAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGACTTCTGGTCGTGC |
Downstream region at tRNA end position |
aaattttaaa |
Secondary structure (Cloverleaf model) | >WENV170014792 Leu GAG t ACCA aaattttaaa G - C C - G C - G G - C G + T A - T G - C T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G G TGACTTCTGGTCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |