Sequence ID | >WENV170014802 |
Genome ID | AZIB01001391 |
Phylum/Class | [AZIB] marine sediment metagenome; sample MGS-HAV from oil contaminated site at the Gulf of Genoa where a Haven tanker sank in |
Species | |
Start position on genome | 428 |
End posion on genome | 337 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cctgccttct |
tRNA gene sequence |
GGAGAGGTGGCCGAGCGGCTGAAGGCGCTCCCCTGCTAAGGGAGTATGGGCTTTAAATCC |
Downstream region at tRNA end position |
tctattgaat |
Secondary structure (Cloverleaf model) | >WENV170014802 Ser GCT t GCCA tctattgaat G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATGGGCTTTAAATCCCATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |