Sequence ID | >WENV170014804 |
Genome ID | AZIB01001415 |
Phylum/Class | [AZIB] marine sediment metagenome; sample MGS-HAV from oil contaminated site at the Gulf of Genoa where a Haven tanker sank in |
Species | |
Start position on genome | 3080 |
End posion on genome | 3169 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccttccttat |
tRNA gene sequence |
GGAGGGGTGGCTGAGCGGTTGAAAGCACTGGTCTTGAAAACCAGCGTGGGTTAGCGCCCA |
Downstream region at tRNA end position |
ttctttaagn |
Secondary structure (Cloverleaf model) | >WENV170014804 Ser TGA t GCCA ttctttaagn G - C G - C A - T G - C G - C G - C G - C T A T G T C C C A C G A G | | | | | G G G T C G C A G G G C G | | | T T T A A G C T G A A CGTGGGTTAGCGCCCACC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |