Sequence ID | >WENV170014824 |
Genome ID | AZIB01004184 |
Phylum/Class | [AZIB] marine sediment metagenome; sample MGS-HAV from oil contaminated site at the Gulf of Genoa where a Haven tanker sank in |
Species | |
Start position on genome | 664 |
End posion on genome | 750 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aagcatcctt |
tRNA gene sequence |
GCCGGGATGGCGGAATTGGTAGACGCAGTGGATTCAAAATCCACCGGTGGTAACACTGTG |
Downstream region at tRNA end position |
actattttat |
Secondary structure (Cloverleaf model) | >WENV170014824 Leu CAA t ACCA actattttat G + T C - G C - G G - C G - C G - C A - T T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G A CGGTGGTAACACTGT G - C T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |