Sequence ID | >WENV170015484 |
Genome ID | AZIH01000062 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 18521 |
End posion on genome | 18597 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttcgctgaac |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAGGGGACTCATAATCCCTTGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
ttccatcccg |
Secondary structure (Cloverleaf model) | >WENV170015484 Met CAT c ACCA ttccatcccg G - C G - C G - C C - G C - G T + G A - T T G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A A TGGTC G + T G - C G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |