Sequence ID | >WENV170015489 |
Genome ID | AZIH01000462 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 652 |
End posion on genome | 568 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cttgcagtta |
tRNA gene sequence |
GCGGACGTGGTGGAATTGGTAGACACGCCAGATTTAGGTTCTGGTGCCGTAAGGTGTGAG |
Downstream region at tRNA end position |
ttttaaaagt |
Secondary structure (Cloverleaf model) | >WENV170015489 Leu TAG a ACCA ttttaaaagt G - C C - G G - C G - C A - T C - G G - C T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G G TGCCGTAAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |