Sequence ID | >WENV170015492 |
Genome ID | AZIH01000510 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 280 |
End posion on genome | 361 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tgaaaataac |
tRNA gene sequence |
GGTGAGATACTCAAGTGGCCAACGAGGGCAGACTGTAAATCTGCTGCGCAAGCTTCGGAG |
Downstream region at tRNA end position |
taatattgga |
Secondary structure (Cloverleaf model) | >WENV170015492 Tyr GTA c ACgt taatattgga G - C G - C T - A G - C A - T G - C A - T T A T C C T C C A T G A A | | | | | G G A C T C G G A G G C G | | | T T C C G A G C A A G TGCGCAAGCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |