Sequence ID | >WENV170015493 |
Genome ID | AZIH01000510 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 416 |
End posion on genome | 491 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aaaaattatt |
tRNA gene sequence |
GCGAGAGTAGCTCAGTTGGTAGAGCTTCAGCCTTCCAAGCTGACTGTCGCCGGTTCGAGC |
Downstream region at tRNA end position |
ttttttttgg |
Secondary structure (Cloverleaf model) | >WENV170015493 Gly TCC t TCTA ttttttttgg G - C C - G G - C A - T G - C A - T G - C C G T T G G C C A T G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A T CTGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |