Sequence ID | >WENV170015500 |
Genome ID | AZIH01001415 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 513 |
End posion on genome | 588 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aggtctgaac |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
ggacgacgca |
Secondary structure (Cloverleaf model) | >WENV170015500 Ala TGC c ACCA ggacgacgca G - C G - C G + T G - C C - G C - G A - T C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |