Sequence ID | >WENV170015508 |
Genome ID | AZIH01001793 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 620 |
End posion on genome | 545 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tccctatgtg |
tRNA gene sequence |
GTGGACGTAGCTCAGTTGGTAGAGCTCAGGATTGTGACTCCTGCGGTCGAGGGTTCGATC |
Downstream region at tRNA end position |
cttttctttc |
Secondary structure (Cloverleaf model) | >WENV170015508 His GTG g CCCA cttttctttc G - C T - A G - C G - C A - T C - G G - C C T T T T C C C A T G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A T CGGTC C - G A - T G - C G - C A - T T C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |