Sequence ID | >WENV170015518 |
Genome ID | AZIH01002610 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1034 |
End posion on genome | 960 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
attcagtttt |
tRNA gene sequence |
AGGGGTATCGCCAAGCGGTAAGGCAACGGGTTTTGATCCCGTCATGCGGAGGTTCGAATC |
Downstream region at tRNA end position |
ttttcagatt |
Secondary structure (Cloverleaf model) | >WENV170015518 Gln TTG t GCCA ttttcagatt A - T G - C G - C G - C G - C T - A A - T T A T C C T C C A G A C | | | | | G C A C C G G G A G G C G | | | T T G A G G C T A A CATGC A - T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |