Sequence ID | >WENV170015521 |
Genome ID | AZIH01002863 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 4672 |
End posion on genome | 4748 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttcaagtttt |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGTTGCCCTCCGGAGGCAAAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
gataaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170015521 Arg CCG t ACCA gataaaaaaa G + T C - G G - C C - G C - G C - G G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |