Sequence ID | >WENV170015540 |
Genome ID | AZIH01003577 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 256 |
End posion on genome | 181 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gaggagttaa |
tRNA gene sequence |
TGGGGTATCGCCAAGTTGGTAAGGCACTGGATTCTGATTCCAGCATGCGTAGGTTCGAGT |
Downstream region at tRNA end position |
tatattatga |
Secondary structure (Cloverleaf model) | >WENV170015540 Gln CTG a GCCA tatattatga T - A G - C G - C G - C G - C T - A A - T T G T C A T C C A T G A C | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A CATGC C - G T - A G - C G - C A - T T T T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |