Sequence ID | >WENV170015546 |
Genome ID | AZIH01004184 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 6100 |
End posion on genome | 6027 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tgtttgcgta |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACGGCAGCTTCCCAAGCTGCACACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
tttctatctt |
Secondary structure (Cloverleaf model) | >WENV170015546 Gly CCC a TCCA tttctatctt G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T T G G A G G G C G | | | | T T G G A A C T A G ACAC G - C C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |