Sequence ID | >WENV170015553 |
Genome ID | AZIH01004615 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 718 |
End posion on genome | 794 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tgcaggacac |
tRNA gene sequence |
AGGACCATAGCTCAGTTGGTTAGAGCGCTGCCTTGACATGGCAGAGGTCGGCAGTTCAAA |
Downstream region at tRNA end position |
ttcctgcaag |
Secondary structure (Cloverleaf model) | >WENV170015553 Val GAC c ACCA ttcctgcaag A - T G - C G - C A - T C - G C - G A - T T A T C C G T C A T G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A G - C C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |