Sequence ID | >WENV170015558 |
Genome ID | AZIH01004981 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1079 |
End posion on genome | 1153 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttaacgtttc |
tRNA gene sequence |
TGCAGGGTAGAGCAGTGGCAGCTCATCGGGCTCATATCCCGAAGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
aatttcgatt |
Secondary structure (Cloverleaf model) | >WENV170015558 Met CAT c ACCA aatttcgatt T - A G - C C - G A - T G - C G - C G - C T A T C G A C C A G A A | | | | | G T C G A G G C T G G C G | | | | T T G G C T C C A A AGGTC T - A C - G G - C G - C G - C C T T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |