Sequence ID | >WENV170015566 |
Genome ID | AZIH01005261 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1462 |
End posion on genome | 1537 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gccccctcac |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
ttctcatttc |
Secondary structure (Cloverleaf model) | >WENV170015566 Val TAC c ACCA ttctcatttc G - C G - C G - C T - A G - C A - T T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |