Sequence ID | >WENV170015569 |
Genome ID | AZIH01005366 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1844 |
End posion on genome | 1755 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agcccccatc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAATGCGGCGGTCTTGAAAACCGTTGAGCGTGTGAGCGTT |
Downstream region at tRNA end position |
ttgctctatt |
Secondary structure (Cloverleaf model) | >WENV170015569 Ser TGA c GCCA ttgctctatt G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G A C G C A G G G C G | | | T T T A T G C C G A G TGAGCGTGTGAGCGTTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |