Sequence ID | >WENV170015576 |
Genome ID | AZIH01005564 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 248 |
End posion on genome | 173 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgattaaatg |
tRNA gene sequence |
GTGGTTGTAGCTCAGCTGGTTAGAGCGCCGGATTGTGGTTCCGGAGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
attaaaaggt |
Secondary structure (Cloverleaf model) | >WENV170015576 His GTG g CCAa attaaaaggt G - C T - A G - C G - C T T T T G - C C A T T G G C C A C G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |