Sequence ID | >WENV170015579 |
Genome ID | AZIH01006159 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 7454 |
End posion on genome | 7379 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cctcggtctt |
tRNA gene sequence |
AGGGGTATAGCTCAGCTGGTAGAGCGACGGTCTCCAAAACCGTAGGTCCCGGGTTCGAAC |
Downstream region at tRNA end position |
agaccacatg |
Secondary structure (Cloverleaf model) | >WENV170015579 Trp CCA t GCCA agaccacatg A - T G - C G - C G - C G - C T + G A - T C A T G G T C C A C G A A | | + | | G T C T C G C C G G G C G | | | | T T G G A G C T A G AGGTC A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |