Sequence ID | >WENV170015589 |
Genome ID | AZIH01007307 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2726 |
End posion on genome | 2802 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gcgcagccat |
tRNA gene sequence |
CGGAGTATAGCTCAGCTTGGTAGAGTACTACGTTCGGGACGTAGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
aatgccgaat |
Secondary structure (Cloverleaf model) | >WENV170015589 Pro CGG t ACCA aatgccgaat C - G G - C G - C A - T G - C T - A A - T T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C T | | | + T T G G A G T G T A A GGGTC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |