Sequence ID | >WENV170015590 |
Genome ID | AZIH01007590 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 406 |
End posion on genome | 482 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctcaataaat |
tRNA gene sequence |
GGCGTGGTAGCTCAGTTGGTTAGAGCGTCGGATTCATAACCCGGAGGTCTGCAGTTCAAT |
Downstream region at tRNA end position |
aattaagaat |
Secondary structure (Cloverleaf model) | >WENV170015590 Met CAT t ACAA aattaagaat G + T G - C C - G G - C T - A G - C G + T T T T A C G T C A T G A A | | | | | A T C T C G T G C A G C G | | | | T T G G A G C T T A G AGGTC T + G C - G G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |