Sequence ID | >WENV170015596 |
Genome ID | AZIH01008978 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 213 |
End posion on genome | 137 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cacccacttt |
tRNA gene sequence |
AGGACTATAGCTCAGTTGGTTAGAGCGCTACCTTGACATGGTAGAGGTCCCCAGTTCGAA |
Downstream region at tRNA end position |
agaattctgc |
Secondary structure (Cloverleaf model) | >WENV170015596 Val GAC t ACCA agaattctgc A - T G - C G - C A - T C - G T - A A - T T A T G G G T C A T G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |