Sequence ID | >WENV170015605 |
Genome ID | AZIH01010668 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 14988 |
End posion on genome | 15063 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgcgcaacat |
tRNA gene sequence |
GCCCGGATAGCTCAGTTGGTAGAGCAGGGGATTGAAAATCCCCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
ctaaattcaa |
Secondary structure (Cloverleaf model) | >WENV170015605 Phe GAA t ACCA ctaaattcaa G - C C - G C - G C - G G - C G - C A - T T T T C C G C C A T G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |