Sequence ID | >WENV170015606 |
Genome ID | AZIH01010916 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 117 |
End posion on genome | 192 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttagagttac |
tRNA gene sequence |
AGGCCAGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGCTGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
attttcccaa |
Secondary structure (Cloverleaf model) | >WENV170015606 Trp CCA c GCCA attttcccaa A - T G - C G - C C - G C - G A - T G - C T G T C T C C C A T A A A | + | | | G T C T T G G G G G G C G | | + | T T G G A G C T A A CTGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |