Sequence ID | >WENV170015616 |
Genome ID | AZIH01011787 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 96 |
End posion on genome | 22 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cggcctcagt |
tRNA gene sequence |
TGGGATGTAGCCAAGTGGTAAGGCAACTGTTTTTGGTACAGTGTACCGTAGGTTCGAATC |
Downstream region at tRNA end position |
attttctgaa |
Secondary structure (Cloverleaf model) | >WENV170015616 Gln TTG t GCCA attttctgaa T - A G - C G - C G - C A - T T - A G - C T A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GTACC A - T C - G T - A G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |