Sequence ID | >WENV170015621 |
Genome ID | AZIH01012135 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 829 |
End posion on genome | 903 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tcgtgacgat |
tRNA gene sequence |
GCTGTGGTAGCTCAGTGGTAGAGCACACCCTTGGTAAGGGTGAGGTCGAGAGTTCAATCC |
Downstream region at tRNA end position |
tatctctttt |
Secondary structure (Cloverleaf model) | >WENV170015621 Thr GGT t ACCA tatctctttt G - C C - G T - A G - C T - A G - C G + T C T T C T C T C A G A A | | | | | A T C T C G G A G A G C G | | | | T T G G A G C T A A AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |