Sequence ID | >WENV170015622 |
Genome ID | AZIH01012170 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 893 |
End posion on genome | 983 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgcgtgttac |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCTGAAGGCGCTCCCCTGCTAAGGGAGTATATCTCAAAAGGGT |
Downstream region at tRNA end position |
ctttgtggtt |
Secondary structure (Cloverleaf model) | >WENV170015622 Ser GCT c GCCA ctttgtggtt G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T G A G | | | | | G G G C C G G C G G G C G | | | T T C A G G C T G A G TATATCTCAAAAGGGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |